This is a collection of no-cost software, data sets, student projects and instructor notes. There are links to software programs that are open access, public domain or freely available under academic license. I believe that the student needs to be able to use the analysis software after the course is over and even after they graduate. Learning wonderful commercial software is not useful if it isn't available to the student. These programs can be downloaded by the student (or anyone), used on their computer and retained, long after the course is over. Most of the site is open to the public but The Instructor's Notes section is password protected. This area contains completed projects, potential student problems and solutions and in some cases, the answers. Any faculty or instructor wishing access just needs to contact me to be given access. Email ELB Please send your name, institution and position. If using gmail or a webmail based service, send the email to earl.blewett@okstate.edu
DNA Trace Files: Also called a chromatogram, a DNA trace file holds the data from a dideoxy sequencing experiment.
Click here for more information, and an example file
DNA Sequence File Types: Most DNA sequence files are text files with a header region that contains more information. The sequence is IUPAC letters. As text files, they can be edited in any text editing program. Do remember to save them as *.txt files as you don't want any extra formatting (e.g. Word, WordPerfect) added.
Click here for more information, and example files
RNA Sequence File Types:
Like DNA sequence file types, most RNA sequence files are text files.
Click here for more information
Amino Acid File Types: Proteins (or peptides) are also easily stored as text files, using single letter or three letter AA code. Like DNA sequence file types, most files contain a header with additional information and a body, that contains the amino acid sequence. Click here for more information and for examples files
Restriction Enzymes: Restriction enzymes (RE's) are proteins that recognize a particular site in the DNA sequence and cut at or near the site in a consistent manner. There are several types of RE's but I'm only going to talk about Type II enzymes, as they are used the most in molecular genetics. Click for more information, links to RE sources and examples
DNA Modifying Enzymes: RE's cut DNA but there are a lot of other useful enzymes used to change DNA. Ligase is a good example and is used to join ends of DNA strands. Click here for more infomration, links to enzyme sources and examples.
Open Reading Frames: an open reading frame is portion of DNA sequence that could code for a protein. At its simplest, an orf is a codon for a translation start (ATG) followed by sequence encodes amino acids, followed by a translational stop codon (TAA,TAG, TGA). The presence or absence of upstream regulatory regions will suggest the orf is a real or not.
I'm an Associate Professor of Microbiology at Oklahoma State University - Center for Health Sciences. I started using programs to analyze DNA and proteins back in the late 1980's when I was a graduate student. In the interim I've used many commercial and free programs for DNA assembly, analysis, aligment, phlylogeny etc. While I use a commercial software for most of my research, DNAStar, no financial interest, I use open source software in the courses I teach. One of my main areas of research are viruses of non-human primates, especially Herpesviruses. My laboratory and collaborators have cloned, sequenced and analyzed a number of primate cytomegaloviruses. Another major area of interest for me is viral diagnostics in non-human primates. I have developed and validated DNA-based diagnostic assays. The data sets and projects in this section are based on real data.
In Bioinformatics there are many occasions when nucleic acid or protein sequences are aligned and compared. A monospace font like Courier New uses equal widths for each letter. This page is rendered in Inteval Book, a new monospace font, developed in 2012 by Alex Chavot. You are seeing it if your browser supports the @fontface command. Otherwise you are seeing Lucinda or Courier New. Please click here for more information on Interval or FontSquirrel.
Query: 538 CAACACCATCAAAAAACAAGATCTGGACTACNTTGGGAGGAGATNTCAT 490
|||||||||||| ||||| ||||| | || || | || | || |||
Sbjct: 3486 CAACACCATCAACAAACAGGATCTAATCAACATTTGTAGAAAATTCCAT 3534